SubtiBank SubtiBank
ycdG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycdG

general stress protein, similar to oligo-1,6-glucosidase
locus
BSU_02840
pI
5.21
mw
65.64 kDa
protein length
561 aa Sequence Blast
gene length
1686 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
3.2.1.10
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    306,459 308,144

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (16)-alpha-D-glucosidic linkages in some oligosaccharides produced from starch and glycogen by alpha-amylase, and in isomaltose (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|YugT], [protein|2EB9E0C492DF57DF683817E31D6DD34D7580E631|TreA], [protein|6E5AB4620F9A896C32CD77AF314C67035814AE0A|MalL]
  • Structure

  • [PDB|1UOK] (from ''Bacillus Cereus'', 54% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF]-[gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]
    description
    [Pubmed|15805528]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528,11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE02840 ([gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGCAATCCCCCTGTT, downstream forward: _UP4_TAATGATTGAAGTAGCCCGG
  • BKK02840 ([gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGCAATCCCCCTGTT, downstream forward: _UP4_TAATGATTGAAGTAGCCCGG
  • References

  • 11544224