SubtiBank SubtiBank
thiI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

thiI

sulfuryl transferase, biosynthesis of 4-thiouridine in tRNA
locus
BSU_29580
pI
9.66
mw
40.17 kDa
protein length
401 aa Sequence Blast
gene length
1206 bp Sequence Blast
function
biosynthesis of 4-thiouridine in tRNA
product
sulfuryl transferase
essential
no
synonyms
ytbJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    3,025,748 3,026,953

    The protein

    Catalyzed reaction/ biological activity

  • receives a sulfuryl group from [protein|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|NifZ] and transfers it to uridine at position 8 of tRNA [Pubmed|22773787]
  • [ThiI sulfur-carrier protein]-S-sulfanyl-L-cysteine + uridine in tRNA + ATP + H+ + 2 reduced [2Fe-2S]-[ferredoxin] --> [ThiI sulfur-carrier protein]-L-cysteine + 4-thiouridine in tRNA + AMP + diphosphate + 2 oxidized [2Fe-2S]-[ferredoxin] (according to UniProt)
  • [sulfur-carrier protein ThiS]-C-terminal Gly-Gly-AMP + AH2 + S-sulfanyl-L-cysteinyl-[cysteine desulfurase] --> [sulfur-carrier protein ThiS]-C-terminal Gly-NH-CH2-C(O)SH + A + AMP + H+ + L-cysteinyl-[cysteine desulfurase] (according to UniProt)
  • Protein family

  • thiI family (single member, according to UniProt)
  • [SW|Domains]

  • THUMP domain (aa 60-165) (according to UniProt)
  • Structure

  • [PDB|4KR6] (ThiI-RNA complex from Thermotoga maritima) [pubmed|24705700]
  • [PDB|2C5S] (from B. anthracis) [pubmed|16343540]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]-[gene|A64A59C2B15015F13911EC53763D370F780400FD|thiI]-[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE29580 ([gene|A64A59C2B15015F13911EC53763D370F780400FD|thiI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATATATGATCGTAATTCA, downstream forward: _UP4_TAAATCAATTTTCAGCTCCT
  • BKK29580 ([gene|A64A59C2B15015F13911EC53763D370F780400FD|thiI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATATATGATCGTAATTCA, downstream forward: _UP4_TAAATCAATTTTCAGCTCCT
  • References

  • 14567704,22773787,16343540,24705700