SubtiBank SubtiBank
kinC [2019-09-16 09:53:54]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

kinC [2019-09-16 09:53:54]

two-component sensor kinase, phosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A], part of the [SW|phosphorelay], governs expression of genes involved in [SW|biofilm formation]
48.68 kDa
protein length
428 aa Sequence Blast
gene length
1287 bp Sequence Blast
initiation of [SW|sporulation]
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|The kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|The kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,518,333 1,519,619

    Phenotypes of a mutant

  • defective in [SW|biofilm formation] [Pubmed|22882210]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] as part of the [SW|phosphorelay], but also direct phosphorylation of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] [Pubmed|19114652]
  • mainly active in the younger, outer regions of a colony (with [protein|511E71BB1981758857854C8E9BF657287CE60C11|KinD]) [Pubmed|21097618]
  • phosphorylates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] in response to the presence of surfactin [Pubmed|22882210], this has been refuted [Pubmed|25701730]
  • required for initiation of [SW|sliding] together with [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB] [Pubmed|26152584]
  • [SW|Domains]

  • two transmembrane segments
  • [SW|PAS domain] (aa 76-147) (according to UniProt)
  • [SW|PAC domain] (aa 148-22) (according to UniProt)
  • [SW|Histidin kinase domain] (aa 221-426) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • activity is triggered by potassium leakage [Pubmed|19114652], this has been refuted [Pubmed|25701730]
  • activity is triggered by polyisoprenoid lipids formed by [protein|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|YisP] [Pubmed|20713508]
  • activity is stimulated by the interaction with [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] [Pubmed|26297017]
  • Structure

  • [PDB|3A0R] (HK-RR complex from Thermotoga maritima, 28% identity) [pubmed|19836334]
  • [SW|Localization]

  • cell membrane (Heterogeneous) [Pubmed|16479537]
  • co-localizes with [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] in discrete foci in the membrane [Pubmed|20713508]
  • the localization of [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC] in membrane microdomains depends on [protein|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|FloA] and [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] [Pubmed|22882210], this has been refuted [Pubmed|25701730]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002614], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|8002615], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • constitutively expressed [Pubmed|12562800]
  • view in new tab

    Biological materials


  • 1A632 ( ''kinC''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • BAL393 (''kinC''::''spc'')[Pubmed|26152584]
  • BKE14490 ([gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACCACCTGCCGCTT, downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA
  • BKK14490 ([gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACCACCTGCCGCTT, downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA
  • References


  • 25934647,25652542
  • Original publications

  • 26152584,19114652,10094672,11069677,16166384,20713508,8002615,16479537,8002614,20946851,20971918,21097618,22882210,23927765,25701730,26297017,26152584,28461449,19836334