SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


23.60 kDa
protein length
218 aa Sequence Blast
gene length
657 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,228,135 1,228,791

    The protein

    Protein family

  • [SW|TerC family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B152 (yjbE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11510 ([gene|A657642FF74E8810AAF9E1859F02FF50076D4B66|yjbE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGCGGCACCTCGCTT, downstream forward: _UP4_TAAAAGAAGGCTGATGACTC
  • BKK11510 ([gene|A657642FF74E8810AAF9E1859F02FF50076D4B66|yjbE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGCGGCACCTCGCTT, downstream forward: _UP4_TAAAAGAAGGCTGATGACTC