SubtiBank SubtiBank
udk
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

udk

uridine kinase
locus
BSU_27330
pI
5.38
mw
24.34 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
function
UMP synthesis
product
uridine kinase
essential
no
ec
2.7.1.48
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    2,792,218 2,792,853

    The protein

    Catalyzed reaction/ biological activity

  • ATP + uridine --> ADP + H+ + UMP (according to UniProt)
  • ATP + cytidine --> ADP + CMP + H+ (according to UniProt)
  • Protein family

  • uridine kinase family (single member, according to UniProt)
  • Structure

  • [PDB|3W8R] (from Thermus thermophilus, 55% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]-[gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]-[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]-[gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]-[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE27330 ([gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTGGATTCTTACCCATGG, downstream forward: _UP4_TAATACCATAGCATAGACAT
  • BKK27330 ([gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTGGATTCTTACCCATGG, downstream forward: _UP4_TAATACCATAGCATAGACAT