SubtiBank SubtiBank
ytoQ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytoQ

unknown
locus
BSU_29850
pI
5.77
mw
16.65 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,054,746 3,055,192

    Expression and Regulation

    Operons

    genes
    [gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B532 (ytoQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1531 NBRP B. subtilis, Japan]
  • BKE29850 ([gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAAAATCCCTCCTT, downstream forward: _UP4_TAAGAAAAAAGCTTGTCGAT
  • BKK29850 ([gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAAAATCCCTCCTT, downstream forward: _UP4_TAAGAAAAAAGCTTGTCGAT
  • BP1101 ([gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]::kan trp+) available at [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs
  • Expression vectors

  • IPTG inducible expression of Strep-ytoQ in E. coli: pBP641 (in [SW|pGP172]) and pBP642 (in [SW|pGP574]), available in [SW|Fabian Commichau]'s lab
  • Constitutive expression of ytoQ in B. subtilis: pBP639 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab, [Pubmed|29027347]
  • pBP770: expression of Strep-''ytoQ'' by [SW|pGP380]in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke's] and [SW|Fabian Commichau]'s labs
  • pBP779: expression of ''ytoQ''-Strep by [SW|pGP382] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs
  • lacZ fusion

  • pBP638 (in [SW|pAC7]), available in [SW|Fabian Commichau]'s lab [Pubmed|29027347]
  • labs

  • [SW|Fabian Commichau], Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
  • References

    Research papers

  • 11918677,29027347