The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
ytoQ
Genomic Context
categories
[category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]Gene
Coordinates
3,054,746 3,055,192
Expression and Regulation
Operons
genes
[gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]
description
[pubmed|22383849]
view in new tabBiological materials
Mutant
MGNA-B532 (ytoQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1531 NBRP B. subtilis, Japan]BKE29850 ([gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAAAATCCCTCCTT, downstream forward: _UP4_TAAGAAAAAAGCTTGTCGATBKK29850 ([gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAAAATCCCTCCTT, downstream forward: _UP4_TAAGAAAAAAGCTTGTCGATBP1101 ([gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]::kan trp+) available at [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labsExpression vectors
IPTG inducible expression of Strep-ytoQ in E. coli: pBP641 (in [SW|pGP172]) and pBP642 (in [SW|pGP574]), available in [SW|Fabian Commichau]'s labConstitutive expression of ytoQ in B. subtilis: pBP639 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab, [Pubmed|29027347]pBP770: expression of Strep-''ytoQ'' by [SW|pGP380]in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke's] and [SW|Fabian Commichau]'s labspBP779: expression of ''ytoQ''-Strep by [SW|pGP382] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labslacZ fusion
pBP638 (in [SW|pAC7]), available in [SW|Fabian Commichau]'s lab [Pubmed|29027347]labs
[SW|Fabian Commichau], Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]References