SubtiBank SubtiBank
smiA
The papers of the month are back! Check them out! Link here

smiA

swarming motility inhibitor A, adaptor protein for [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA]-mediated degradation of [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]
locus
BSU35319
pI
4.00
mw
15.00 kDa
protein length
125 aa Sequence Blast
gene length
375 bp Sequence Blast
function
control of swarming motility
product
adaptor protein for [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA]-mediated degradation of [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]
essential
no
synonyms
yvzG

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    Coordinates
    3,631,763 → 3,632,140

    Phenotypes of a mutant

  • presence of predifferentiated swarmer cells in liquid medium [Pubmed|25538299]
  • A mutation in ''smiA'' suppresses the motility defect of a ''[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]'' mutant [Pubmed|19542270]
  • Expression and Regulation

    Operons

    genes
    [gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]-[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]-[gene|06FEA5F205B40DD5CF8D9F1328E940D4543F4741|S1350]-[gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • available in the [SW|Daniel Kearns] lab
  • BKE35319 (Δ[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35319 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCACTCACCTATTTAC, downstream forward: _UP4_TAGGCGTGTGTGAGGTATTT
  • BKK35319 (Δ[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35319 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCACTCACCTATTTAC, downstream forward: _UP4_TAGGCGTGTGTGAGGTATTT
  • Labs working on this gene/protein

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]
  • References

  • 19542270,25538299,26577401,29311275