SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


swarming motility inhibitor A, adaptor protein for [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA]-mediated degradation of [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrAA/1]
15.00 kDa
protein length
125 aa Sequence Blast
gene length
375 bp Sequence Blast
control of swarming motility
adaptor protein for [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|LonA]-mediated degradation of [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrAA/1]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    3,631,763 → 3,632,140

    Phenotypes of a mutant

  • presence of predifferentiated swarmer cells in liquid medium [Pubmed|25538299]
  • A mutation in ''smiA'' suppresses the motility defect of a ''[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]'' mutant [Pubmed|19542270]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • available in the [SW|Daniel Kearns] lab
  • BKE35319 (Δ[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCACTCACCTATTTAC, downstream forward: _UP4_TAGGCGTGTGTGAGGTATTT
  • BKK35319 (Δ[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCACTCACCTATTTAC, downstream forward: _UP4_TAGGCGTGTGTGAGGTATTT
  • Labs working on this gene/protein

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [ homepage]
  • References

  • 19542270,25538299,26577401