SubtiBank SubtiBank
ykoM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykoM

similar to transcriptional regulator ([SW|MarR family])
locus
BSU_13340
pI
9.47
mw
17.72 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    1,398,496 1,398,960

    The protein

    Paralogous protein(s)

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]
  • Structure

  • [PDB|3ZPL] (from Steptomyces coelicolor, corresponds to aa 17 ... 142, 24.6% identity) [pubmed|23748564]
  • Expression and Regulation

    Operons

    genes
    [gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG, downstream forward: _UP4_TTTCGTTAACTATTCTACAC
  • BKK13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG, downstream forward: _UP4_TTTCGTTAACTATTCTACAC
  • GP2873 (''[gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]''::''zeo''), available in [SW|Jörg Stülke]'s lab
  • References

    Research papers

  • 23748564