SubtiBank SubtiBank
yetM

yetM

FAD-dependent monooxygenase
locus
BSU_07230
pI
5.34
mw
40.82 kDa
protein length
369 aa Sequence Blast
gene length
1110 bp Sequence Blast
function
unknown
product
FAD-dependent monooxygenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    790,318 791,427

    The protein

    [SW|Cofactors]

  • FAD (according to UniProt) [Pubmed|21635694]
  • Structure

  • [PDB|4H2N] (from Mesorhizobium japonicum, 30% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]
    description
    [Pubmed|19329649]

    regulatory mechanism

  • [protein|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|YetL]: repression, [Pubmed|19329649], in [regulon|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|YetL regulon]
  • regulation

  • induced by flavonoids of kaempferol, apigenin, and luteolin ([protein|search|YetL])[Pubmed|19329649]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B464 (yetM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1463 NBRP B. subtilis, Japan]
  • BKE07230 ([gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATAACCACCTTTT, downstream forward: _UP4_TAAATAGGAAAAGTCCAGAA
  • BKK07230 ([gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAATAACCACCTTTT, downstream forward: _UP4_TAAATAGGAAAAGTCCAGAA
  • References

  • 19329649,19329649