SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


Putative DNA-binding protein
16.43 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,580,121 1,580,552

    The protein

    Protein family

  • mraZ family (single member, according to UniProt)
  • [SW|Domains]

  • 2 [SW|SpoVT-AbrB domain]s (aa 7-47, aa 76-119) (according to UniProt)
  • Structure

  • [PDB|1N0G] (the homolog from ''Mycoplasma pneumoniae'') [Pubmed|15146477]
  • [SW|Localization]

  • nucleoid (heterogeneous) [Pubmed|16479537]
  • Expression and Regulation




  • constitutively expressed [Pubmed|15758244]
  • view in new tab

    Biological materials


  • MGNA-B129 (yllB::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A817 ( ''mraZ''::''erm''), [Pubmed|12682299], available at [ BGSC]
  • BKE15130 ([gene|A7131ACFA0CF5C222237C76E502D4AAD1F9BA3E4|mraZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTCTTGCCCCACTT, downstream forward: _UP4_TAATGATTCTTCGTGTATAA
  • BKK15130 ([gene|A7131ACFA0CF5C222237C76E502D4AAD1F9BA3E4|mraZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTCTTGCCCCACTT, downstream forward: _UP4_TAATGATTCTTCGTGTATAA
  • References

  • 8636036,16479537,8244929,16511046,15146477