SubtiBank SubtiBank
padR
The papers of the month are back! Check them out! Link here

padR

repressor of [gene|1E0BA378F14ADF03D613DA3BF3241C1ADE75075E|yveF]-[gene|1F56C126099E1D5241069E06477F277C12B20C58|yveG]-[gene|ECA64CB1E4BF8B6B0854B1B63C9E85A519059C6C|padC], induction occurs by binding of phenolic acids,stress response
locus
BSU08340
pI
7.23
mw
21.08 kDa
protein length
182 aa Sequence Blast
gene length
546 bp Sequence Blast
function
regulation of the phenolic acid stress response
product
transcriptional repressor
essential
no
synonyms
yfiO

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    909,198 → 909,746

    The protein

    [SW|Domains]

  • N-terminal winged helix-turn-helix (wHTH) domain (NTD) [pubmed|29136175]
  • C-terminal homodimerization domain (CTD) [pubmed|29136175]
  • Effectors of protein activity

  • phenolic acid acts as molecular inducer and releases PadR from the'' [gene|1E0BA378F14ADF03D613DA3BF3241C1ADE75075E|yveF]-[gene|1F56C126099E1D5241069E06477F277C12B20C58|yveG]-[gene|ECA64CB1E4BF8B6B0854B1B63C9E85A519059C6C|padC]'' promoter [Pubmed|18326577]
  • Structure

  • [PDB|5X12] (PadR) [pubmed|29136175]
  • [PDB|5X11] (complex with dsDNA) [pubmed|29136175]
  • [PDB|5X13] (complex with p-coumaric acid) [pubmed|29136175]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A7824EACE0C109C676A374FD21F59D671B703305|padR]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/padR.html DBTBS]) null

    regulation

  • weak constitutive expression
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C303 (yfiO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2301 NBRP B. subtilis, Japan]
  • BKE08340 (Δ[gene|A7824EACE0C109C676A374FD21F59D671B703305|padR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCTCCGTGTCTG, downstream forward: _UP4_TAACCGCAGTTCAGGCTGCA
  • BKK08340 (Δ[gene|A7824EACE0C109C676A374FD21F59D671B703305|padR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCTCCGTGTCTG, downstream forward: _UP4_TAACCGCAGTTCAGGCTGCA
  • References

  • 18326577,21685295,29136175