SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


Na /H antiporter
47.89 kDa
protein length
453 aa Sequence Blast
gene length
1362 bp Sequence Blast
pH homeostasis
Na /H antiporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Sodium uptake/ export]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.5|PH homeostasis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,042,885 1,044,246

    The protein

    Protein family

  • NhaC Na(+)/H(+) (TC 2.A.35) antiporter family (with [protein|49DF23B8E19658DB32835B6D23DD21E4BF481B20|MleN], according to UniProt)
  • Paralogous protein(s)

  • [protein|49DF23B8E19658DB32835B6D23DD21E4BF481B20|MleN]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D0BBFE1706429A98B7E93998794061A112FE8ECA|NhaX]: activation, (probably) [Pubmed|11274110], in [regulon|D0BBFE1706429A98B7E93998794061A112FE8ECA|NhaX regulon]
  • regulation

  • subject to indirect positive regulation by [protein|search|CodY] [Pubmed|24843172]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-A707 (yheL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09680 ([gene|A7F1B4C0D32E18773170BFBEEB94E5EF55C7DB97|nhaC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATAACACCCCATATTT, downstream forward: _UP4_TAAAAAGAGCCCCGCTGTAA
  • BKK09680 ([gene|A7F1B4C0D32E18773170BFBEEB94E5EF55C7DB97|nhaC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATAACACCCCATATTT, downstream forward: _UP4_TAAAAAGAGCCCCGCTGTAA
  • References


  • 27935846
  • Original publications

  • 11274110,21815947,24843172