SubtiBank SubtiBank
yqfB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqfB

resistence protein (against sublancin), accessory role in resistance to cefuroxime
locus
BSU_25370
pI
11.17
mw
15.60 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
function
resistance against sublancin
product
resistence protein (against sublancin)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,617,005 2,617,424

    The protein

    [SW|Localization]

  • cell membrane [Pubmed|22753055]
  • Expression and Regulation

    Operons

    genes
    [gene|F6B0D27B434D81B7A680555E4457F266B6206B7D|yqeZ]-[gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]-[gene|A80317C3B8DF06E2187E02A05C13845508C18B40|yqfB]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed under stress conditions ([protein|search|SigW]) [Pubmed|11866510]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C453 (yqfB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2451 NBRP B. subtilis, Japan]
  • BKE25370 ([gene|A80317C3B8DF06E2187E02A05C13845508C18B40|yqfB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGTTCTCCCTTCTT, downstream forward: _UP4_TAAAGTGTTAGAACCTCCTT
  • BKK25370 ([gene|A80317C3B8DF06E2187E02A05C13845508C18B40|yqfB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGTTCTCCCTTCTT, downstream forward: _UP4_TAAAGTGTTAGAACCTCCTT
  • References

  • 16629676,11866510,22753055