SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative pyrophosphatase
12.83 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
putative pyrophosphatase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,360,155 2,360,490

    The protein


  • [PDB|2GTA]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials


  • BKE22500 ([gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAACGAAACCTCCTAT, downstream forward: _UP4_GAAGGAAAGTAGAGGAGATC
  • BKK22500 ([gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAACGAAACCTCCTAT, downstream forward: _UP4_GAAGGAAAGTAGAGGAGATC
  • lacZ fusion

  • pGP2437 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

    Operon and expression

  • 20308541,23894131