SubtiBank SubtiBank
ypjD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypjD

putative pyrophosphatase
locus
BSU_22500
pI
4.95
mw
12.83 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
putative pyrophosphatase
essential
no
synonyms
jojD

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,360,155 2,360,490

    The protein

    Structure

  • [PDB|2GTA]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]-[gene|5AB90032031653A913E15B26B3E1AE246E95AABF|dapB]-[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]-[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]-[gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]-[gene|4C4FA59FF5D100E941EF470C0C54E85681ADC74F|cca]-[gene|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA]
    description
    [Pubmed|20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • BKE22500 ([gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAACGAAACCTCCTAT, downstream forward: _UP4_GAAGGAAAGTAGAGGAGATC
  • BKK22500 ([gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAACGAAACCTCCTAT, downstream forward: _UP4_GAAGGAAAGTAGAGGAGATC
  • lacZ fusion

  • pGP2437 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

    Operon and expression

  • 20308541,23894131