SubtiBank SubtiBank
yhbH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhbH

[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]-dependent [SW|sporulation] gene
locus
BSU_08980
pI
6.10
mw
45.17 kDa
protein length
392 aa Sequence Blast
gene length
1179 bp Sequence Blast
function
[category|SW 4.2|Sporulation]
product
unknown
essential
no
synonyms
yzdC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    975,231 976,409

    Phenotypes of a mutant

  • defect in sporulation [Pubmed|14523133]
  • The protein

    Protein family

  • UPF0229 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A84688E551F146A71452628CB5012F7ACD36F126|yhbH]
    description
    [Pubmed|9579061]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A734 (yhbH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/734 NBRP B. subtilis, Japan]
  • BKE08980 ([gene|A84688E551F146A71452628CB5012F7ACD36F126|yhbH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATTCCCCTCCTTAAC, downstream forward: _UP4_TAATGAAAAGCCCATTTCAG
  • BKK08980 ([gene|A84688E551F146A71452628CB5012F7ACD36F126|yhbH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATTCCCCTCCTTAAC, downstream forward: _UP4_TAATGAAAAGCCCATTTCAG
  • References

  • 12662922,9579061,14523133