SubtiBank SubtiBank
adeC

adeC

adenine deaminase
locus
BSU_14520
pI
4.72
mw
62.64 kDa
protein length
577 aa Sequence Blast
gene length
1734 bp Sequence Blast
function
utilization of adenine as nitrogen source,purine salvage and interconversion
product
adenine deaminase
essential
no
ec
3.5.4.2
synonyms
ade,yzaD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    1,521,351 1,523,084

    The protein

    Catalyzed reaction/ biological activity

  • Adenine + H2O --> hypoxanthine + NH3 (according to UniProt)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Structure

  • [PDB|3NQB] (from Agrobacterium tumefaciens, 31% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14520 ([gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT, downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
  • BKK14520 ([gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT, downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
  • References

  • 8550522