SubtiBank SubtiBank
adeC [2018-10-12 17:54:32]
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

adeC [2018-10-12 17:54:32]

adenine deaminase
62.64 kDa
protein length
577 aa Sequence Blast
gene length
1731 bp Sequence Blast
utilization of adenine as nitrogen source,purine salvage and interconversion
adenine deaminase
ade, yzaD

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    1,521,351 → 1,523,084

    The protein

    Catalyzed reaction/ biological activity

  • Adenine + H2O = hypoxanthine + NH3 (according to Swiss-Prot)
  • Protein family

  • adenine deaminase family (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE14520 (Δ[gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT, downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
  • BKK14520 (Δ[gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT, downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
  • References

  • 8550522