SubtiBank SubtiBank
adeC [2018-10-12 17:54:32]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

adeC [2018-10-12 17:54:32]

adenine deaminase
locus
BSU14520
pI
4.72
mw
62.64 kDa
protein length
577 aa Sequence Blast
gene length
1731 bp Sequence Blast
function
utilization of adenine as nitrogen source,purine salvage and interconversion
product
adenine deaminase
essential
no
ec
3.5.4.2
synonyms
ade, yzaD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    1,521,351 → 1,523,084

    The protein

    Catalyzed reaction/ biological activity

  • Adenine + H2O = hypoxanthine + NH3 (according to Swiss-Prot)
  • Protein family

  • adenine deaminase family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14520 (Δ[gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT, downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
  • BKK14520 (Δ[gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT, downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
  • References

  • 8550522