SubtiBank SubtiBank
adeC [2019-08-01 08:52:57]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

adeC [2019-08-01 08:52:57]

adenine deaminase
62.64 kDa
protein length
577 aa Sequence Blast
gene length
1734 bp Sequence Blast
utilization of adenine as nitrogen source,purine salvage and interconversion
adenine deaminase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    1,521,351 1,523,084

    The protein

    Catalyzed reaction/ biological activity

  • Adenine + H2O = hypoxanthine + NH3 (according to Swiss-Prot)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Structure

  • [PDB|3NQB] (from Agrobacterium tumefaciens, 31% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE14520 ([gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT, downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
  • BKK14520 ([gene|A85EB6E97AC9B2CA46BA6EF315BDA72A035DD3E7|adeC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAGGCCCCTCCTTTTT, downstream forward: _UP4_TAAAAAGAGGCACTCCCTTA
  • References

  • 8550522