SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative B12-independent methionine synthase
42.96 kDa
protein length
378 aa Sequence Blast
gene length
1137 bp Sequence Blast
putative methionine synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine/ based on similarity]
  • Gene

    3,999,350 4,000,486

    The protein

    Paralogous protein(s)

  • [protein|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|YxjH]
  • Modification

  • S-bacillithiolation upon hypochlorite stress on Cys-346 [Pubmed|21749987]
  • Structure

  • [PDB|1YPX] (the enzyme from ''Listeria monocytogenes'', 49% identity)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B731 (yxjG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38960 ([gene|A866ACE8431EC3FF98ADC734D9322AE699ECBFAD|yxjG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTCCATTCCTTCTT, downstream forward: _UP4_TAAGCAAAGAAAAAAACACA
  • BKK38960 ([gene|A866ACE8431EC3FF98ADC734D9322AE699ECBFAD|yxjG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTCCATTCCTTCTT, downstream forward: _UP4_TAAGCAAAGAAAAAAACACA
  • References

  • 19258532,10094622,18039762,12107147,21749987,29794222