SubtiBank SubtiBank
mutL
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

mutL

DNA mismatch repair
locus
BSU17050
pI
5.58
mw
70.25 kDa
protein length
627 aa Sequence Blast
gene length
1881 bp Sequence Blast
function
DNA repair
product
DNA mismatch repair
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • Gene

    Coordinates
    1,778,337 → 1,780,220

    Phenotypes of a mutant

  • 60-fold increased mutation rate [Pubmed|23882084]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]'' mutant is not viable [Pubmed|23882084]
  • The protein

    Protein family

  • DNA mismatch repair mutL/hexB family (according to Swiss-Prot)
  • Structure

  • [PDB|3KDK] (C-terminal domain) [Pubmed|20603082]
  • [SW|Localization]

  • forms foci at midcell position, the frequency of foci increases upon mismatch formation [Pubmed|21958350]
  • Expression and Regulation

    Operons

    genes
    [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]
    description
    [Pubmed|8760914]

    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mutL]' and '[protein|search|ymzD]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • GP1190 (Δ[gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::''aphA3'') [Pubmed|22178973], available in [SW|Jörg Stülke]'s lab
  • 1A833 ( ''mutL''::''spec''), [Pubmed|11779496], available at [http://bgsc.org/search.php?Search=1A833 Bacillus Genetic Stock Center]
  • BKE17050 (Δ[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCACATTCATCACCC, downstream forward: _UP4_TAGCGGGGGTGGTAGGCATT
  • BKK17050 (Δ[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCACATTCATCACCC, downstream forward: _UP4_TAGCGGGGGTGGTAGGCATT
  • References

    Reviews

  • 22933559,26354434,26343983
  • Original publications

  • 8760914,15375129,20603082,20525796,22843852,21050827,21958350,22178973,23882084,23998896,25326311,26384423,26163658,27369079,27851738