SubtiBank SubtiBank
mutL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mutL

sequence-unspecific endonuclease, DNA mismatch repair
locus
BSU_17050
pI
5.58
mw
70.25 kDa
protein length
627 aa Sequence Blast
gene length
1884 bp Sequence Blast
function
DNA repair
product
DNA mismatch repair protein, sequence-unspecific endonuclease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.7|Mismatch repair (MMR)]
  • Gene

    Coordinates
    1,778,337 1,780,220

    Phenotypes of a mutant

  • 60-fold increased mutation rate [Pubmed|23882084]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]'' mutant is not viable [Pubmed|23882084]
  • The protein

    Protein family

  • DNA mismatch repair mutL/hexB family (single member, according to UniProt)
  • Structure

  • [PDB|3KDK] (C-terminal domain) [Pubmed|20603082]
  • [PDB|6E8D] (complexed with [protein|83E05071DEC874248D3E96B8F3A093C65939B314|DnaN]) [Pubmed|30916336]
  • [SW|Localization]

  • forms foci at midcell position, the frequency of foci increases upon mismatch formation [Pubmed|21958350]
  • Expression and Regulation

    Operons

    genes
    [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]
    description
    [Pubmed|8760914]

    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mutL]' and '[protein|search|ymzD]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • GP1190 ([gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::''aphA3'') [Pubmed|22178973], available in [SW|Jörg Stülke]'s lab
  • 1A833 ( ''mutL''::''spec''), [Pubmed|11779496], available at [http://bgsc.org/search.php?Search=1A833 Bacillus Genetic Stock Center]
  • BKE17050 ([gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCACATTCATCACCC, downstream forward: _UP4_TAGCGGGGGTGGTAGGCATT
  • BKK17050 ([gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCACATTCATCACCC, downstream forward: _UP4_TAGCGGGGGTGGTAGGCATT
  • References

    Reviews

  • 22933559,26354434,26343983
  • Original publications

  • 8760914,15375129,20603082,20525796,22843852,21050827,21958350,22178973,23882084,23998896,25326311,26384423,26163658,27369079,27851738,30391220,30916336