SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


DNA mismatch repair
70.25 kDa
protein length
627 aa Sequence Blast
gene length
1881 bp Sequence Blast
DNA repair
DNA mismatch repair

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • Gene

    1,778,337 → 1,780,220

    Phenotypes of a mutant

  • 60-fold increased mutation rate [Pubmed|23882084]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]'' mutant is not viable [Pubmed|23882084]
  • The protein

    Protein family

  • DNA mismatch repair mutL/hexB family (according to Swiss-Prot)
  • Structure

  • [PDB|3KDK] (C-terminal domain) [Pubmed|20603082]
  • [SW|Localization]

  • forms foci at midcell position, the frequency of foci increases upon mismatch formation [Pubmed|21958350]
  • Expression and Regulation



    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mutL]' and '[protein|search|ymzD]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • GP1190 (Δ[gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::''aphA3'') [Pubmed|22178973], available in [SW|Jörg Stülke]'s lab
  • 1A833 ( ''mutL''::''spec''), [Pubmed|11779496], available at [ Bacillus Genetic Stock Center]
  • BKE17050 (Δ[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCACATTCATCACCC, downstream forward: _UP4_TAGCGGGGGTGGTAGGCATT
  • BKK17050 (Δ[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCACATTCATCACCC, downstream forward: _UP4_TAGCGGGGGTGGTAGGCATT
  • References


  • 22933559,26354434,26343983
  • Original publications

  • 8760914,15375129,20603082,20525796,22843852,21050827,21958350,22178973,23882084,23998896,25326311,26384423,26163658,27369079,27851738