SubtiBank SubtiBank
mutL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mutL

sequence-unspecific endonuclease, DNA mismatch repair
locus
BSU17050
pI
5.58
mw
70.25 kDa
protein length
627 aa Sequence Blast
gene length
1884 bp Sequence Blast
function
DNA repair
product
DNA mismatch repair protein, sequence-unspecific endonuclease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.7|Mismatch repair (MMR)]
  • Gene

    Coordinates
    1,778,337 1,780,220

    Phenotypes of a mutant

  • 60-fold increased mutation rate [Pubmed|23882084]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]'' mutant is not viable [Pubmed|23882084]
  • The protein

    Protein family

  • DNA mismatch repair mutL/hexB family (according to Swiss-Prot)
  • Structure

  • [PDB|3KDK] (C-terminal domain) [Pubmed|20603082]
  • [PDB|6E8D] (complexed with [protein|83E05071DEC874248D3E96B8F3A093C65939B314|DnaN]) [Pubmed|30916336]
  • [SW|Localization]

  • forms foci at midcell position, the frequency of foci increases upon mismatch formation [Pubmed|21958350]
  • Expression and Regulation

    Operons

    genes
    [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]
    description
    [Pubmed|8760914]

    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mutL]' and '[protein|search|ymzD]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • GP1190 ([gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::''aphA3'') [Pubmed|22178973], available in [SW|Jörg Stülke]'s lab
  • 1A833 ( ''mutL''::''spec''), [Pubmed|11779496], available at [http://bgsc.org/search.php?Search=1A833 Bacillus Genetic Stock Center]
  • BKE17050 ([gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCACATTCATCACCC, downstream forward: _UP4_TAGCGGGGGTGGTAGGCATT
  • BKK17050 ([gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCACATTCATCACCC, downstream forward: _UP4_TAGCGGGGGTGGTAGGCATT
  • References

    Reviews

  • 22933559,26354434,26343983
  • Original publications

  • 8760914,15375129,20603082,20525796,22843852,21050827,21958350,22178973,23882084,23998896,25326311,26384423,26163658,27369079,27851738,30391220,30916336