SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


N-acetylmuramoyl-L-alanine amidase
33.71 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast
PBSX prophage-mediated lysis
N-acetylmuramoyl-L-alanine amidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.6|Phage-related functions]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,317,535 1,318,488

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
  • Protein family

  • [SW|N-acetylmuramoyl-L-alanine amidase 2 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|CwlA], [protein|D5612882F1887BE342EF7072E71502382AB7289F|CwlH], [protein|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|XlyA]
  • [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] [Pubmed|18430080]
  • contains an amidase_2 domain (like [protein|C1EB8D05386C1B35B8002239F5247CC6AB25F786|BlyA], [protein|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|CwlA], [protein|D5612882F1887BE342EF7072E71502382AB7289F|CwlH], [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|XlyB])
  • [SW|N-acetylmuramoyl-L-alanine amidase domain] (aa 40-142) (according to UniProt)
  • [SW|LysM domain] (aa 177-221) (according to UniProt)
  • Structure

  • [PDB|2L47] (from Bacillus phage Gamma, corresponds to aa 3 ... 166, 57% identity)
  • [SW|Localization]

  • secreted (according to UniProt)
  • Expression and Regulation


    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • BKE12460 ([gene|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|xlyB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTATCATCTCTCCTTTT, downstream forward: _UP4_TAAATGAAAAGACGGAAGCT
  • BKK12460 ([gene|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|xlyB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTATCATCTCTCCTTTT, downstream forward: _UP4_TAAATGAAAAGACGGAAGCT
  • References


  • 18430080
  • Original publications

  • 12884008