SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum, [SW|cell division] initiation protein (septum placement), part of the Min system (with Z ring placement)
19.20 kDa
protein length
164 aa Sequence Blast
gene length
495 bp Sequence Blast
division site selection, chromosome segregation and control of peptidoglycan homeostasis
[SW|cell division] initiation protein, member of the [SW|divisome]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|The Min system]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|Other genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    1,612,521 1,613,015

    Phenotypes of a mutant

  • Deletion of ''divIVA'' leads to filamentation and polar divisions that in turn cause a minicell phenotype [pubmed|9219999]
  • A ''divIVA'' mutant has a moderate [pubmed|26735940] to severe [pubmed|11445541] [SW|sporulation] defect
  • The protein

    Catalyzed reaction/ biological activity

  • curvature sensitive membrane binding protein that recruits other proteins to the poles and the division septum
  • DivIVA is required for polar localisation of [protein|8C94C9598A823A8405B3E1FA0124E21D90845B8E|MinC]-[protein|37DAD42A391E2FC506225EAF91B8F21629A401DF|MinD] via [protein|C3482F13AE7B7462D9A4C91C8B461B7987A2277D|MinJ]. [Pubmed|19019154]
  • It also recruits [protein|09E9194E82DF199527F414DB0EC15547A71AD25E|RacA] to the distal pole of the prespore [Pubmed|12493822].
  • DivIVA may anchor [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|SpoIIE] briefly to the assembling polar septum before [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|SpoIIE] is subsequently released into the forespore membrane and recaptured at the polar septum [Pubmed|25101664]
  • required for the compartment-specific activation of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] [Pubmed|25101664]
  • activates [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] [Pubmed|25845974]
  • required for oriC placement during spore development [Pubmed|27059541]
  • Protein family

  • DivIVA family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|C22F7704DC9D36D96FE089ADCEA546D7A3FB3739|GpsB]
  • [SW|Domains]

  • the first 60 amino acids constitute a conserved lipid binding domain [Pubmed|30887576,19478798]
  • the C-terminal domain is less conserved
  • multimerisation involves two coiled-coil motifs, one in the lipid binding domain, and the other one being present in the helical C-terminal domain [Pubmed|18388125] [Pubmed|23264578]
  • Modification

  • phosphorylated on Arg-102 [Pubmed|22517742]
  • The ''Mycobacterium'' DivIVA homologue Wag31 is phosphorylated at T73 [Pubmed|15985609]
  • DivIVA from ''Streptococcus pneumoniae'' is phosphorylated at Threonine 201 by the Ser/Thr protein kinase Sktp1. [Pubmed|20453092][Pubmed|22211696]
  • [SW|Cofactors]

  • not known
  • Effectors of protein activity

  • not known
  • Structure

  • [PDB|2WUJ] (N-terminal domain) [Pubmed|20502438]
  • [SW|Localization]

  • DivIVA forms a ring underneath the invaginating membrane at the site of cell division and is enriched at both cell poles [Pubmed|9219999]
  • forms rings at the division septum and patches at the cell poles [Pubmed|22108385]
  • membrane targeting requires [protein|AD7CD451B4AE638A719C91780339784A7FF0F248|SecA] [Pubmed|24592260]
  • assembles into a ring-like structure at the polar septum during [SW|sporulation] [Pubmed|25101664]
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials


  • 4041 (''divIVA''::''tet''), available in [SW|Leendert Hamoen]'s, [SW|Jörg Stülke]'s, and [SW|Sven Halbedel] 's lab
  • GP1482 (chromosomal ''divIVA''-Strep fusion, ''aphA''3), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • BKE15420 ([gene|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACCTCCATTTT, downstream forward: _UP4_TAAATTCTCTGATTATCTTG
  • BKK15420 ([gene|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|divIVA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCACCTCCATTTT, downstream forward: _UP4_TAAATTCTCTGATTATCTTG
  • Expression vectors

  • DivIVA-Strep available [ here]
  • pGP1497 (N-terminal Strep-tag fused to C-terminus of ''divIVA'', TEV-site, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • divIVA-gfp fusions available from the [ Hamoen] Lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Sven Halbedel]'s and [SW|Jörg Stülke]'s labs
  • FLAG-tag construct

  • GP1776 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • A polyclonal anti-DivIVA antiserum generated in rabbit is described here [Pubmed|11445541].
  • labs

  • [SW|Leendert Hamoen], Centre for Bacterial Cell Biology, Newcastle upon Tyne, United Kingdom [ x]
  • [SW|Imrich Barak], Slovak Academy of Science, Bratislava, Slovakia [ homepage]
  • [SW|Sven Halbedel], Robert Koch Institute [ homepage]
  • References


  • 19654604,19884039,22722244,23182676,28697666,29355854,29522747,30887576,31405912
  • Original Publications

  • 22582279,19654604,19666580,9219999,19019154,15554965,12368265,11445541,10835369,12511520,14651647,19478798,19429628,11445541,9219999,9045828,20352045,20502438,11886553,21564336,22108385,22457634,22517742,22661688,23264578,23701187,23927765,24391905,24592260,24600441,25101664,25845974,27059541,26735940,28674273,16885474,31821790