SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcription repressor of the pur operon
31.08 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
regulation of purine biosynthesis
transcription repressor of the pur operon

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    54,441 55,298

    The protein

    Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Effectors of protein activity

  • PRPP acts as inducer, binding results in release of PurR from the operator [Pubmed|10919400]
  • Structure

  • [PDB|1O57], 1O57 [ NCBI] [Pubmed|12837783]
  • Additional information

  • requires [protein|285D9E676B06119F9F4D33FC62615EC844D35BC3|YabJ] for ''in vivo'' activity
  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, [Pubmed|7638212], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • negative autoregulation [Pubmed|7638212]
  • view in new tab

    Biological materials


  • BKE00470 ([gene|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACTCACCCCCAAAAT, downstream forward: _UP4_TTAAAGAATGGAGAGACAGA
  • BKK00470 ([gene|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACTCACCCCCAAAAT, downstream forward: _UP4_TTAAAGAATGGAGAGACAGA
  • References


  • 28031352
  • Original publications

  • 10368157,14594850,15629952,11591660,12837783,7638212,12837784,19446032,10919400