SubtiBank SubtiBank
yugT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yugT

similar to exo-alpha-1,4-glucosidase
locus
BSU_31290
pI
4.97
mw
63.82 kDa
protein length
554 aa Sequence Blast
gene length
1665 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
3.2.1.10
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,214,372 3,216,036

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (1->6)-alpha-D-glucosidic linkages in some oligosaccharides produced from starch and glycogen by alpha-amylase, and in isomaltose (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2EB9E0C492DF57DF683817E31D6DD34D7580E631|TreA], [protein|A641BA91317CBCFE34A2BE69007247F209075095|YcdG], [protein|6E5AB4620F9A896C32CD77AF314C67035814AE0A|MalL]
  • Structure

  • [PDB|2ZE0] (from Geobacillus sp., 64% identity), [pubmed|18398906]
  • Expression and Regulation

    Operons

    genes
    [gene|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|yugT]
    description
    [Pubmed|9274030]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B547 (yugT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1546 NBRP B. subtilis, Japan]
  • BKE31290 ([gene|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|yugT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCCACTCCTTCCCA, downstream forward: _UP4_TAAACTCCAGCCTTAGACTG
  • BKK31290 ([gene|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|yugT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCCACTCCTTCCCA, downstream forward: _UP4_TAAACTCCAGCCTTAGACTG
  • References

  • 9274030,12642660,18398906