SubtiBank SubtiBank
yugT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yugT

similar to exo-alpha-1,4-glucosidase
locus
BSU_31290
pI
4.97
mw
63.82 kDa
protein length
554 aa Sequence Blast
gene length
1665 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
3.2.1.10
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,214,372 3,216,036

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (1->6)-alpha-D-glucosidic linkages in some oligosaccharides produced from starch and glycogen by alpha-amylase, and in isomaltose (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2EB9E0C492DF57DF683817E31D6DD34D7580E631|TreA], [protein|A641BA91317CBCFE34A2BE69007247F209075095|YcdG], [protein|6E5AB4620F9A896C32CD77AF314C67035814AE0A|MalL]
  • Structure

  • [PDB|2ZE0] (from Geobacillus sp., 64% identity), [pubmed|18398906]
  • Expression and Regulation

    Operons

    genes
    [gene|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|yugT]
    description
    [Pubmed|9274030]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B547 (yugT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1546 NBRP B. subtilis, Japan]
  • BKE31290 ([gene|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|yugT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCCACTCCTTCCCA, downstream forward: _UP4_TAAACTCCAGCCTTAGACTG
  • BKK31290 ([gene|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|yugT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGCCACTCCTTCCCA, downstream forward: _UP4_TAAACTCCAGCCTTAGACTG
  • References

  • 9274030,12642660,18398906