SubtiBank SubtiBank
rhiL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rhiL

[SW|ABC transporter] (sugar-binding protein) for rhamnose oligosaccharides
locus
BSU_06970
pI
4.99
mw
46.45 kDa
protein length
427 aa Sequence Blast
gene length
1284 bp Sequence Blast
function
uptake of rhamnose oligosaccharides
product
rhamnose oligosaccharide [SW|ABC transporter]
essential
no
synonyms
yesO

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    761,662 762,945

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Structure

  • [PDB|4R6K]
  • [PDB|5Z6B] (complexed with rhamnogalacturonan trisaccharide)
  • [PDB|5Z6C] (complexed with rhamnogalacturonan)
  • [SW|Localization]

  • associated to the membrane (via [protein|2DC415DCC2ECC3B46526108638DDB46C28832041|RhiF]-[protein|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|RhiG]) [Pubmed|10092453]
  • Biological materials

    Mutant

  • MGNA-A947 (yesO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/947 NBRP B. subtilis, Japan]
  • BKE06970 ([gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCCCTTTAA, downstream forward: _UP4_AATGAGATATTAGAGAGGAA
  • BKK06970 ([gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCCCTTTAA, downstream forward: _UP4_AATGAGATATTAGAGAGGAA
  • References

  • 10092453,17449691,24391637