SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|ABC transporter] (sugar-binding protein) for rhamnose oligosaccharides
46.45 kDa
protein length
427 aa Sequence Blast
gene length
1284 bp Sequence Blast
uptake of rhamnose oligosaccharides
rhamnose oligosaccharide [SW|ABC transporter]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    761,662 762,945

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Structure

  • [PDB|4R6K]
  • [PDB|5Z6B] (complexed with rhamnogalacturonan trisaccharide) [pubmed|33122638]
  • [PDB|5Z6C] (complexed with rhamnogalacturonan) [pubmed|33122638]
  • [SW|Localization]

  • associated to the membrane (via [protein|2DC415DCC2ECC3B46526108638DDB46C28832041|RhiF]-[protein|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|RhiG]) [Pubmed|10092453]
  • Expression and Regulation




  • induced in colonies growing on steamed soybeans [Pubmed|33122638]
  • view in new tab

    Biological materials


  • MGNA-A947 (yesO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06970 ([gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCCCTTTAA, downstream forward: _UP4_AATGAGATATTAGAGAGGAA
  • BKK06970 ([gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCCCTTTAA, downstream forward: _UP4_AATGAGATATTAGAGAGGAA
  • References

  • 10092453,17449691,24391637,33122638