SubtiBank SubtiBank
adeR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

adeR

transcription activator ([SW|PucR family]) for [gene|2D346CF412BA32EE18111DA930CFA1306F95024B|ald] gene expression
locus
BSU_31920
pI
8.15
mw
50.14 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
control of [gene|2D346CF412BA32EE18111DA930CFA1306F95024B|ald] expression
product
transcription activator ([SW|PucR family])
essential
no
synonyms
yukF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.7|Utilization of alanine/ serine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,276,955 3,278,223

    Phenotypes of a mutant

  • [SW|sporulation] defect due to lack of ''[gene|2D346CF412BA32EE18111DA930CFA1306F95024B|ald]'' expression [Pubmed|22797752]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription activation of ''[gene|2D346CF412BA32EE18111DA930CFA1306F95024B|ald]'' gene expression in the presence of alanine [Pubmed|22797752]
  • Protein family

  • [SW|PucR family]
  • [SW|CdaR family] (according to UniProt)
  • Modification

  • phosphorylated on Ser-395 [Pubmed|20509597]
  • Effectors of protein activity

  • L-alanine [Pubmed|22797752]
  • Expression and Regulation

    Operons

    genes
    [gene|A987E1510578E8DE822C2019488D457CB7CFBE73|adeR]
    description
    [Pubmed|8226620]

    regulation

  • constitutively expressed [Pubmed|22797752]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A631 (yukF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/631 NBRP B. subtilis, Japan]
  • BKE31920 ([gene|A987E1510578E8DE822C2019488D457CB7CFBE73|adeR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATCCCCTTCCTTTT, downstream forward: _UP4_TGAAATTTCACAAATCCATG
  • BKK31920 ([gene|A987E1510578E8DE822C2019488D457CB7CFBE73|adeR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATCCCCTTCCTTTT, downstream forward: _UP4_TGAAATTTCACAAATCCATG
  • References

  • 8226620,20509597,22797752