SubtiBank SubtiBank
ykuI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykuI

c-di-GMP binding protein
locus
BSU_14090
pI
4.46
mw
47.80 kDa
protein length
407 aa Sequence Blast
gene length
1224 bp Sequence Blast
function
unknown
product
c-di-GMP binding protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.2|Targets of c-di-GMP]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,482,248 1,483,471

    Phenotypes of a mutant

  • inactivation of ''[gene|A9C45C522EAF534C41CB75AA364A379E1D11055F|ykuI]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
  • The protein

    [SW|Domains]

  • EAL domain (aa 1-250) (according to UniPort)
  • PAS-like domain (aa 300-400) [Pubmed|19244251]
  • Structure

  • [PDB|2BAS]
  • in complex with c-di-GMP [PDB|2W27] [Pubmed|19244251]
  • Expression and Regulation

    Operons

    genes
    [gene|69E475F00D9CCFDDF086F0B8A5CBA81B31DD06FE|ykuH]-[gene|A9C45C522EAF534C41CB75AA364A379E1D11055F|ykuI]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A770 (ykuI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/770 NBRP B. subtilis, Japan]
  • GP1324 (tet), available in [SW|Jörg Stülke]'s lab
  • BKE14090 ([gene|A9C45C522EAF534C41CB75AA364A379E1D11055F|ykuI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCTGCTTCTC, downstream forward: _UP4_TAACGGCTGAAAGGCCGTTT
  • BKK14090 ([gene|A9C45C522EAF534C41CB75AA364A379E1D11055F|ykuI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCTGCTTCTC, downstream forward: _UP4_TAACGGCTGAAAGGCCGTTT
  • References

  • 23893111,19244251,22821967,27116468,27935957