SubtiBank SubtiBank
gltB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gltB

small subunit of glutamate synthase
locus
BSU_18440
pI
7.70
mw
54.78 kDa
protein length
493 aa Sequence Blast
gene length
1482 bp Sequence Blast
function
glutamate biosynthesis
product
glutamate synthase (small subunit)
essential
no
ec
1.4.1.13
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • Gene

    Coordinates
    2,008,572 2,010,053

    Phenotypes of a mutant

  • auxotrophic for glutamate
  • The protein

    Catalyzed reaction/ biological activity

  • 2 L-glutamate NADP = L-glutamine 2-oxoglutarate NADPH (according to Swiss-Prot) 2 L-glutamate NADP( ) <=> L-glutamine 2-oxoglutarate NADPH
  • Protein family

  • glutamate synthase family (with [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|GltA] and [protein|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|YerD], according to UniProt)
  • [SW|Domains]

  • nucleotide binding domain (NADP) (299313)
  • Structure

  • [PDB|2VDC] (the [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|GltA]-[protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|GltB] complex of ''Azospirillum brasiliense'') [Pubmed|18199747]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2548995], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|11029411], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]: activation, [Pubmed|2548995], in [regulon|87BCAE725B02860156D50E1783F6DB68510C811E|GltC regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: indirect effect, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • expressed in the presence of ammonium [Pubmed|11029411]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition,
  • Biological materials

    Mutant

  • BP123 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''ermC'') , available in [SW|Fabian Commichau]'s lab
  • GP807 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''tet'') , available in [SW|Jörg Stülke]'s lab
  • GP517 (Δ[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • BKE18440 ([gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCTCTCCCCTTCCT, downstream forward: _UP4_TAAATAAAGGGGATTATCAT
  • BKK18440 ([gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCTCTCCCCTTCCT, downstream forward: _UP4_TAAATAAAGGGGATTATCAT
  • Expression vectors

  • pGP1119 (in [SW|pGP380], for SPINE, expression in ''B. subtilis''), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • pGP3031: IPTG inducible expression, purification in ''E. coli'' with C-terminal His-tag, in [SW|pGP574] (Strep-tag omitted), available in [SW|Jörg Stülke]'s lab
  • pGP3032: IPTG inducible expression, purification in ''E. coli'' with C-terminal Strep-tag, in [SW|pGP574], available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • see ''[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Fabian Commichau], Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
  • References

    Reviews

  • 16143852,12859215,22625175,12859215
  • Original publications

  • 27223617,12823818,20933603,11029411,7559360,15150225,2548995,17183217,17608797,17134717,14523131,12823818,18326565,18199747,22389480,25755103,28294562,29242163