SubtiBank SubtiBank
ydeK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydeK

unknown
locus
BSU_05230
pI
10.41
mw
30.20 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    570,371 571,234

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|EamA domain]s (aa 16-139, aa 158-284) (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C134 (ydeK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2132 NBRP B. subtilis, Japan]
  • BKE05230 ([gene|AA14C45EC1AAC353817AE79647081F747F3F3BF4|ydeK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAATCACTCCACATA, downstream forward: _UP4_TAAGGCAGACCTTTAAGCAT
  • BKK05230 ([gene|AA14C45EC1AAC353817AE79647081F747F3F3BF4|ydeK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAATCACTCCACATA, downstream forward: _UP4_TAAGGCAGACCTTTAAGCAT