SubtiBank SubtiBank
yrzK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yrzK

unknown
locus
BSU_27570
pI
7.33
mw
6.19 kDa
protein length
gene length
171 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,818,191 2,818,361

    The protein

    [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE27570 ([gene|AA267D1BCD38B77CFD5114BBA9DBE016848015E7|yrzK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTGCACACCTTTTT, downstream forward: _UP4_TGACAGAGAACCCCAATCCC
  • BKK27570 ([gene|AA267D1BCD38B77CFD5114BBA9DBE016848015E7|yrzK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTGCACACCTTTTT, downstream forward: _UP4_TGACAGAGAACCCCAATCCC