SubtiBank SubtiBank
iolX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

iolX

scyllo-inositol 2-dehydrogenase
locus
BSU_10850
pI
5.30
mw
37.33 kDa
protein length
342 aa Sequence Blast
gene length
1029 bp Sequence Blast
function
utilization of scyllo-inositol
product
scyllo-inositol 2-dehydrogenase
essential
no
synonyms
yuxD,yucG,yisS

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • Gene

    Coordinates
    1,164,370 1,165,398

    Phenotypes of a mutant

  • impaired growth with scyllo-inositol as the only carbon source [Pubmed|20133360]
  • The protein

    Catalyzed reaction/ biological activity

  • NAD+ + scyllo-inositol --> H+ + NADH + scyllo-inosose (according to UniProt)
  • Protein family

  • [SW|Gfo/Idh/MocA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|YfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|NtdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|YteT], [protein|920C5750CB95102B073C32874D512E8D636D2C7D|IolU], [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|IolG], [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|YrbE], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|IolW]
  • [SW|Cofactors]

  • NAD+ [pubmed|28693424]
  • Structure

  • [PDB|3EZY] (from Thermotoga maritima, 37% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|17F5188958A415D8D09439E02E1D1E0661B5C760|IolQ]: repression, [pubmed|28693424], in [regulon|17F5188958A415D8D09439E02E1D1E0661B5C760|IolQ regulon]
  • regulation
    induced by scyllo-inositol [pubmed|28693424]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B191 (yisS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1190 NBRP B. subtilis, Japan]
  • BKE10850 ([gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCCCATCCTCTCCTTT, downstream forward: _UP4_TAAAAGCTAAGTATGTTGCA
  • BKK10850 ([gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCCCATCCTCTCCTTT, downstream forward: _UP4_TAAAAGCTAAGTATGTTGCA
  • References

  • 20133360,28693424