SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


acetolactate synthase
61.95 kDa
protein length
571 aa Sequence Blast
gene length
1713 bp Sequence Blast
overflow metabolism
acetolactate synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Overflow metabolism]
  • Gene

    3,709,628 → 3,711,340

    The protein

    Catalyzed reaction/ biological activity

  • H+ + 2 pyruvate --> (2S)-2-acetolactate + CO2 (according to UniProt)
  • Protein family

  • [SW|TPP enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|IlvB], [protein|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|YdaP]
  • [SW|Cofactors]

  • Mg2 [Pubmed|25393087]
  • TPP [Pubmed|25393087]
  • FAD (according to UniProt)
  • Structure

  • [PDB|4RJJ] (complex wit TPP) [Pubmed|25393087]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7685336], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR]: activation, in the presence of acetate [Pubmed|7685336], in [regulon|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR regulon]
  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, if the ratio NADH2/NAD is high [Pubmed|16428414], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [regulon|stringent response|stringent response]: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • regulation

  • induction by acetate ([protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR]) [Pubmed|30039521,7685336]
  • expression is heterogeneous [pubmed|29809139]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • 1A979 ( ''alsS''::''cat''), [Pubmed|7685336], available at [ BGSC]
  • BKE36010 (Δ[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACACCCTCACTCCTTATT, downstream forward: _UP4_TAGCACTCTGCGCATCACGA
  • BKK36010 (Δ[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACACCCTCACTCCTTATT, downstream forward: _UP4_TAGCACTCTGCGCATCACGA
  • References

  • 19087206,10986270,20081037,16428414,19383131,7685336,16428414,19684168,24734205,22178965,25393087,29809139,30039521,31113899