SubtiBank SubtiBank
sacB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sacB

levansucrase
locus
BSU_34450
pI
6.18
mw
52.80 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
utilization of sucrose, production of levan
product
levansucrase
essential
no
ec
2.4.1.10
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,536,012 3,537,433

    The protein

    Catalyzed reaction/ biological activity

  • [6)-β-D-fructofuranosyl-(2→](n) α-D-glucopyranoside + sucrose --> [6)-β-D-fructofuranosyl-(2→](n+1) α-D-glucopyranoside + D-glucose (according to UniProt)
  • Protein family

  • glycosyl hydrolase 68 family (single member, according to UniProt)
  • Structure

  • [PDB|1PT2] (complex with sucrose), [PDB|1OYG]
  • [SW|Localization]

  • secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]-[gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]
    description
    [Pubmed|11739774]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2428811], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|2428811], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY]: antitermination, /antitermination via binding to a [SW|RNA switch], in [regulon|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY regulon]
  • regulation

  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT, downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
  • BKK34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT, downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
  • lacZ fusion

  • pGP564 (in [SW|pAC7]), a series of RAT mutations in [SW|pAC7], all available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 20735481
  • Original publications

  • 6402497,2428811,18197985,18957862,2105292,11739774,3039303,22247149,26256357,26600431,26646447,28871528,29131629,28433290,29794222,30301900,30703417