SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cell wall hydrolase (lytic transglycosylase), required for complete dissolution of the asymmetric septum
37.25 kDa
protein length
343 aa Sequence Blast
gene length
1032 bp Sequence Blast
dissolution of the septal cell wall
lytic transglycosylase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,776,722 3,777,753

    The protein

    Catalyzed reaction/ biological activity

  • degrades the glycan strands of the peptidoglycan into disaccharide units [Pubmed|20159959], enhances [protein|C9817A54C8E72193280E393D7BD3375BD1751738|SpoIIP] activity [Pubmed|20159959]
  • required for proper localization of [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] (together with [protein|C9817A54C8E72193280E393D7BD3375BD1751738|SpoIIP]) [Pubmed|23834622]
  • Structure

  • [PDB|4RWR] (from ''B. anthracis'', 54% identity, 74% similarity) [pubmed|27226615]
  • [SW|Localization]

  • cell membrane [Pubmed|20159959]
  • the complex of [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID], [protein|14852D54F8B7344AA80D535F8EBBCE11E2B859CF|SpoIIM], and [protein|C9817A54C8E72193280E393D7BD3375BD1751738|SpoIIP] localizes at the leading edge of the mother cell engulfing membrane and is essential and rate limiting for membrane migration [Pubmed|20382772,12502745]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials


  • BKE36750 ([gene|AAC4BF6FA80115AB90D2B161C1D5383625953616|spoIID]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCAGCTGCCTCCTGC, downstream forward: _UP4_TAGAAAAAGACGCTCATTGG
  • BKK36750 ([gene|AAC4BF6FA80115AB90D2B161C1D5383625953616|spoIID]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCAGCTGCCTCCTGC, downstream forward: _UP4_TAGAAAAAGACGCTCATTGG
  • References


  • 23944268,32660383
  • Original publications

  • 17376078,1946462,11886548,15752199,3011962,15699190,15383836,20159959,20382772,12502745,20444098,23834622,23859254,27226615,31282858