SubtiBank SubtiBank
spoIVFA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoIVFA

inhibitor of [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] metalloprotease
locus
BSU27980
pI
7.29
mw
29.46 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
control of [protein|search|SigK] activation
product
inhibitor of [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] metalloprotease
essential
no
synonyms
bofB,spoVL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,856,832 2,857,626

    The protein

    [SW|Domains]

  • the ectodomain of [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA] is cleaved off by [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|SpoIVB] (first cleavage) [Pubmed|24243021]
  • the domains that inhibits [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] is cleaved off by [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] (second cleavage) [Pubmed|24243021]
  • [SW|Localization]

  • integral mother cell membrane protein [Pubmed|24243021,11959848]
  • Additional information

  • the ectodomain of [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA] is cleaved off by [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|SpoIVB] (first cleavage) [Pubmed|24243021]
  • the domains that inhibits [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] is cleaved off by [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] (second cleavage) {{PubMed|24243021}
  • Expression and Regulation

    Operons

    genes
    [gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]
    description
    [Pubmed|1942049]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,1942049], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab

    genes
    [gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]-[gene|11927EB0448839D047EC7BF70EC65156DAB481D3|rplU]-[gene|B27548A4BBF396C9BA102A80ACB08B21262CEA30|prp]-[gene|4626C659D6F1A81CCC94030F1CBAF7FEC3DE19CA|rpmA]
    description
    [Pubmed|22383849]

    regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab

    Biological materials

    Mutant

  • BKE27980 ([gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCATCATCCTTTGCA, downstream forward: _UP4_ATTGATCCGATTCAGGTGAT
  • BKK27980 ([gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCATCATCCTTTGCA, downstream forward: _UP4_ATTGATCCGATTCAGGTGAT
  • References

  • 11959848,9501233,1577688,15292188,2115401,12940997,9078383,15752199,16818230,15699190,1942049,15383836,17557826,24243021,22383849,30403663