SubtiBank SubtiBank
spoIVFA
The papers of the month are back! Check them out! Link here

spoIVFA

inhibitor of SpoIVFB metalloprotease
locus
BSU27980
pI
7.29
mw
29.46 kDa
protein length
264 aa Sequence Blast
gene length
792 bp Sequence Blast
function
control of SigK activation
product
inhibitor of SpoIVFB metalloprotease
essential
no
synonyms
bofB, spoVL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,856,832 → 2,857,626

    The protein

    [SW|Domains]

  • the ectodomain of [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA] is cleaved off by [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|SpoIVB] (first cleavage) [Pubmed|24243021]
  • the domains that inhibits [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] is cleaved off by [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] (second cleavage) [Pubmed|24243021]
  • [SW|Localization]

  • mother cell membrane [Pubmed|24243021]
  • integral membrane protein [Pubmed|11959848]
  • Additional information

  • the ectodomain of [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA] is cleaved off by [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|SpoIVB] (first cleavage) [Pubmed|24243021]
  • the domains that inhibits [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] is cleaved off by [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] (second cleavage) {{PubMed|24243021}
  • Expression and Regulation

    Operons

    genes
    [gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]
    description
    [Pubmed|1942049]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,1942049], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab

    genes
    [gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]-[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]-[gene|11927EB0448839D047EC7BF70EC65156DAB481D3|rplU]-[gene|B27548A4BBF396C9BA102A80ACB08B21262CEA30|prp]-[gene|4626C659D6F1A81CCC94030F1CBAF7FEC3DE19CA|rpmA]
    description
    [Pubmed|22383849]

    regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab

    Biological materials

    Mutant

  • BKE27980 (Δ[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCATCATCCTTTGCA, downstream forward: _UP4_ATTGATCCGATTCAGGTGAT
  • BKK27980 (Δ[gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCATCATCCTTTGCA, downstream forward: _UP4_ATTGATCCGATTCAGGTGAT
  • References

  • 11959848,9501233,1577688,15292188,2115401,12940997,9078383,15752199,16818230,15699190,1942049,15383836,17557826,24243021,22383849