SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


ribose [SW|ABC transporter] (ATP-binding protein)
54.36 kDa
protein length
493 aa Sequence Blast
gene length
1482 bp Sequence Blast
ribose uptake
ribose [SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of ribose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,703,682 3,705,163

    The protein

    Catalyzed reaction/ biological activity

  • ATP + D-ribose + H2O --> ADP + D-ribose + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|71546D1508EF17A208332E162CAE2C299987A569|NupO]
  • [SW|Domains]

  • 2 [SW|ABC transporter domain]s (aa 3-239, aa 246-493) (according to UniProt)
  • Structure

  • [PDB|1G9X] (from Methanocaldococcus jannaschii, 36% identity) [pubmed|12554933]
  • [SW|Localization]

  • attached to the cell membrane (via [protein|F1258E31151E137A850811B0C851D473CEFFD43B|RbsC]-[protein|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|RbsD]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials


  • BKE35940 ([gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCTGCATGTTTCATCTTC, downstream forward: _UP4_ACACTTGCCACGGGAGGGCG
  • BKK35940 ([gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCTGCATGTTTCATCTTC, downstream forward: _UP4_ACACTTGCCACGGGAGGGCG
  • References

  • 10092453,16872404,7511775,7592460,7921236,12554933