SubtiBank SubtiBank
yjcQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yjcQ

unknown
locus
BSU_11950
pI
5.23
mw
10.89 kDa
protein length
gene length
285 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,267,129 1,267,413

    The protein

    Structure

  • [PDB|2HGC]
  • Expression and Regulation

    Operons

    genes
    [gene|4D4BC14E558C05803A66EB1857E8F7D582AE54B7|yjcP]-[gene|AB905AFBB810E97CF91E141E7B69352014A5488B|yjcQ]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE11950 ([gene|AB905AFBB810E97CF91E141E7B69352014A5488B|yjcQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCTCCTTTCAGTC, downstream forward: _UP4_TAATAAGAGCATCCTGCGGG
  • BKK11950 ([gene|AB905AFBB810E97CF91E141E7B69352014A5488B|yjcQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCTCCTTTCAGTC, downstream forward: _UP4_TAATAAGAGCATCCTGCGGG
  • References

  • 15033535