SubtiBank SubtiBank
ytqA

ytqA

unknown
locus
BSU_30480
pI
5.61
mw
36.61 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,119,999 3,120,967

    The protein

    Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • 4 Fe- 4S cluster [pubmed|29292548]
  • Expression and Regulation

    Operons

    genes
    [gene|AB9762F1D388E27039FEFE946D8BE527CEF13F09|ytqA]-[gene|B7B3DF7FFA4144CBB12A72996C73CFBD7B6DD2D8|ytqB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A129 (ytqA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/129 NBRP B. subtilis, Japan]
  • BKE30480 ([gene|AB9762F1D388E27039FEFE946D8BE527CEF13F09|ytqA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATTCATGTGCCTCCTT, downstream forward: _UP4_CGGCTTGAGGAGGAATCAGC
  • BKK30480 ([gene|AB9762F1D388E27039FEFE946D8BE527CEF13F09|ytqA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATTCATGTGCCTCCTT, downstream forward: _UP4_CGGCTTGAGGAGGAATCAGC