SubtiBank SubtiBank
purM
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

purM

phosphoribosylaminoimidazole synthetase
locus
BSU_06500
pI
4.59
mw
36.90 kDa
protein length
346 aa Sequence Blast
gene length
1041 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylaminoimidazole synthetase
essential
no
ec
6.3.3.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    706,973 708,013

    The protein

    Catalyzed reaction/ biological activity

  • 2-(formamido)-N1-(5-phospho-D-ribosyl)acetamidine + ATP --> 5-amino-1-(5-phospho-β-D-ribosyl)imidazole + ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • AIR synthase family (single member, according to UniProt)
  • Structure

  • [PDB|2BTU] (from ''Bacillus anthracis'', 64% identity, 78% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • 1A601 ( ''purM''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A601&Search=1A601 BGSC]
  • BKE06500 ([gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTATTCACTCCTTTAA, downstream forward: _UP4_ACATTCGGCGGTGCGGCACT
  • BKK06500 ([gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTATTCACTCCTTTAA, downstream forward: _UP4_ACATTCGGCGGTGCGGCACT
  • References

  • 3036807,12923093,7638212