SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


inositol monophosphatase and 5'-nucleotidase with preference for GMP and IMP
29.61 kDa
protein length
265 aa Sequence Blast
gene length
798 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,537,441 1,538,238

    Phenotypes of a mutant

  • sensitive to diamide stress [Pubmed|27784292]
  • The protein

    Catalyzed reaction/ biological activity

  • myo-inositol phosphate + H2O --> myo-inositol + phosphate (according to UniProt)
  • Protein family

  • inositol monophosphatase superfamily (single member, according to UniProt)
  • Structure

  • [PDB|5I3S] (from Staphylococcus aureus, 51% identity)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials


  • MGNA-A908 (yktC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14670 ([gene|AD151804FC145854DB6BAA12CD52758FB1C3882F|yktC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTCGTACCTCTCTT, downstream forward: _UP4_TAGGCCATTTGAGCAGGATG
  • BKK14670 ([gene|AD151804FC145854DB6BAA12CD52758FB1C3882F|yktC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTCGTACCTCTCTT, downstream forward: _UP4_TAGGCCATTTGAGCAGGATG
  • References

  • 19935659,26577401,27784292