SubtiBank SubtiBank
yraN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yraN

similar to transcriptional regulator ([SW|LysR family])
locus
BSU26870
pI
8.97
mw
33.46 kDa
protein length
289 aa Sequence Blast
gene length
870 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|LysR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,745,594 2,746,463

    The protein

    Protein family

  • [SW|LysR family]
  • Structure

  • [PDB|5Z72] (B. amyloliquefaciens [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC], 36% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|AD1C6BA47924F07974680E1E5591DD96BA95A98A|yraN]-[gene|5AE18B11C9E13E5B121673955E01F1B1E8DB1637|yraO]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A262 (yraN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/262 NBRP B. subtilis, Japan]
  • BKE26870 ([gene|AD1C6BA47924F07974680E1E5591DD96BA95A98A|yraN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTTCCTTTCTA, downstream forward: _UP4_TAAAGTTATGATAGAATTTT
  • BKK26870 ([gene|AD1C6BA47924F07974680E1E5591DD96BA95A98A|yraN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTTCCTTTCTA, downstream forward: _UP4_TAAAGTTATGATAGAATTTT
  • References

  • 22383849