SubtiBank SubtiBank
yvaM
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvaM

similar to hydrolase
locus
BSU_33640
pI
8.99
mw
29.43 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,455,472 3,456,242

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|322BE299860795A70EFA78B8E2614CCCC1CE7C87|YdjP]:
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 22-122) (according to UniProt)
  • Structure

  • [PDB|5EGN] (26% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|AD4702CC69AC7D5FF391F14176881D582DD1C68A|yvaM]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yvaM.html DBTBS]) null

    regulatory mechanism

  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|16553878], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • regulation

  • repressed by [protein|search|RghR] [Pubmed|16553878]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A447 (yvaM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/447 NBRP B. subtilis, Japan]
  • BKE33640 ([gene|AD4702CC69AC7D5FF391F14176881D582DD1C68A|yvaM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTTTTCTCCTTTGAC, downstream forward: _UP4_TAGGAATAGAAAACGCTTGG
  • BKK33640 ([gene|AD4702CC69AC7D5FF391F14176881D582DD1C68A|yvaM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTTTTCTCCTTTGAC, downstream forward: _UP4_TAGGAATAGAAAACGCTTGG
  • References

  • 16553878