SubtiBank SubtiBank
glvR
The papers of the month are back! Check them out! Link here

glvR

transcriptional activator of the malA-glvR-malP operon
locus
BSU08190
pI
5.45
mw
29.15 kDa
protein length
254 aa Sequence Blast
gene length
762 bp Sequence Blast
function
regulation of maltose utilization
product
transcriptional activator
essential
no
synonyms
yfiA, malR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.22|Utilization of maltose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    891,436 → 892,200

    Expression and Regulation

    Operons

    genes
    [gene|C650160C9E5B5F8587CA9E80A57BCCE97D701037|malA]-[gene|AD72489DA260F07B97A213F1F0FBA7CED9471817|glvR]-[gene|E6C7733A12AF9A5322EED444E4A4FF1605A8B20F|malP]
    description
    [Pubmed|11489864]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489864], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR]: activation, [Pubmed|11489864], in [regulon|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|11489864], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induction by maltose ([protein|search|GlvR]) [Pubmed|11489864]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C290 (yfiA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2288 NBRP B. subtilis, Japan]
  • BKE08190 (Δ[gene|AD72489DA260F07B97A213F1F0FBA7CED9471817|glvR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAGATCCCCCCATTT, downstream forward: _UP4_AATGACAATGAGTAGCAGGGG
  • BKK08190 (Δ[gene|AD72489DA260F07B97A213F1F0FBA7CED9471817|glvR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAGATCCCCCCATTT, downstream forward: _UP4_AATGACAATGAGTAGCAGGGG
  • References

  • 11489864