SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional activator of the [gene|C650160C9E5B5F8587CA9E80A57BCCE97D701037|malA]-[gene|AD72489DA260F07B97A213F1F0FBA7CED9471817|glvR]-[gene|E6C7733A12AF9A5322EED444E4A4FF1605A8B20F|malP] operon
29.15 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
regulation of maltose utilization
transcriptional activator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of maltose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    891,436 892,200

    The protein


  • HTH rpiR-type domain (aa 1-77) (according to UniProt)
  • [SW|SIS domain] (aa 106-248) (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489864], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR]: activation, [Pubmed|11489864], in [regulon|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|11489864], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induction by maltose ([protein|search|GlvR]) [Pubmed|11489864]
  • view in new tab

    Biological materials


  • MGNA-C290 (yfiA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08190 ([gene|AD72489DA260F07B97A213F1F0FBA7CED9471817|glvR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAGATCCCCCCATTT, downstream forward: _UP4_AATGACAATGAGTAGCAGGGG
  • BKK08190 ([gene|AD72489DA260F07B97A213F1F0FBA7CED9471817|glvR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAGATCCCCCCATTT, downstream forward: _UP4_AATGACAATGAGTAGCAGGGG
  • References

  • 11489864