SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


repressor of the glycolytic [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] operon, [SW|DeoR family]
37.23 kDa
protein length
340 aa Sequence Blast
gene length
1023 bp Sequence Blast
transcriptional regulator
central glycolytic genes regulator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    3,482,752 3,483,774

    Phenotypes of a mutant

  • suppresses the growth defect of [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutants on gluconeogenic substrates [Pubmed|16272399]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription repression of the glycolytic ''[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]'' operon
  • Protein family

  • SorC transcriptional regulatory family (with [protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR], according to UniProt)
  • [SW|Domains]

  • DNA binding domain (H-T-H motif) (3756)
  • Effectors of protein activity

  • fructose 1.6-bisphosphate [Pubmed|29923648,12622823] and dihydroxyacetone phosphate, glucose-6-phosphate and fructose-6-phosphate [Pubmed|18554327] act as inducer and result in release of [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] from the DNA
  • Structure

  • [PDB|3BXH] (in complex with fructose-6-phosphate) [pubmed|18554327]
  • [PDB|2OKG] (effector binding domain) [pubmed|18554327]
  • [SW|Localization]

  • cytoplasma [Pubmed|20572937]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [Pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glycolytic intermediates ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] [Pubmed|11489127]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glucose (10 fold) ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [Pubmed|12850135,12622823]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • MGNA-A463 (yvbQ::erm), available at the [ NBRP B. subtilis, Japan]
  • GP311 (in frame deletion), available in [SW|Jörg Stülke]'s lab
  • SM-NB7 (cggR-spc), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs
  • BKE33950 ([gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAACGTTCCTTC, downstream forward: _UP4_TAATCCCTCAATATAAATAT
  • BKK33950 ([gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAACGTTCCTTC, downstream forward: _UP4_TAATCCCTCAATATAAATAT
  • Expression vectors

  • pGP705 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP504 (in [SW|pAC7]), pGP509 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References


  • 20408793
  • Original Publications

  • 20462860,22190493,23280112,21815947,19193632,12850135,12622823,18186488,10799476,11489127,12123463,12634343,18052209,17293407,20361740,20444087,18554327,25099370,26883633,16272399,29923648,30082753