SubtiBank SubtiBank
cggR
The papers of the month are back! Check them out! Link here

cggR

repressor of the glycolytic [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] operon, [SW|DeoR family]
locus
BSU33950
pI
5.68
mw
37.23 kDa
protein length
340 aa Sequence Blast
gene length
1020 bp Sequence Blast
function
transcriptional regulator
product
central glycolytic genes regulator
essential
no
synonyms
yvbQ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    Coordinates
    3,482,752 → 3,483,774

    Phenotypes of a mutant

  • suppresses the growth defect of [gene|7150BABA5086D5E2EB8102E4901A216F43576282|yvcK] mutants on gluconeogenic substrates [Pubmed|16272399]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription repression of the glycolytic ''[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]'' operon
  • Protein family

  • sorC transcriptional regulatory family (according to Swiss-Prot)
  • [SW|Domains]

  • DNA binding domain (H-T-H motif) (37–56)
  • Effectors of protein activity

  • fructose 1.6-bisphosphate [Pubmed|29923648,12622823] and dihydroxyacetone phosphate, glucose-6-phosphate and fructose-6-phosphate [Pubmed|18554327] act as inducer and result in release of [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] from the DNA
  • Structure

  • [PDB|3BXH] (in complex with fructose-6-phosphate) [pubmed|18554327]
  • [PDB|2OKG] (effector binding domain) [pubmed|18554327]
  • [SW|Localization]

  • cytoplasma [Pubmed|20572937]
  • Expression and Regulation

    Operons

    genes
    [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]-[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]-[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]-[gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]-[gene|C86FB523451AC172A20801829B717E5A5F914211|pgm]-[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]
    description
    [Pubmed|11489127]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [Pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glycolytic intermediates ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] [Pubmed|11489127]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    genes
    [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]-[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]
    description
    [Pubmed|11489127]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glucose (10 fold) ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [Pubmed|12850135,12622823]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-A463 (yvbQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/463 NBRP B. subtilis, Japan]
  • GP311 (in frame deletion), available in [SW|Jörg Stülke]'s lab
  • SM-NB7 (cggR-spc), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs
  • BKE33950 (Δ[gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAACGTTCCTTC, downstream forward: _UP4_TAATCCCTCAATATAAATAT
  • BKK33950 (Δ[gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAACGTTCCTTC, downstream forward: _UP4_TAATCCCTCAATATAAATAT
  • Expression vector

  • pGP705 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP504 (in [protein|search|pAC7]), pGP509 (in [protein|search|pAC6]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

    Reviews

  • 20408793
  • Original Publications

  • 20462860,22190493,23280112,21815947,19193632,12850135,12622823,18186488,10799476,11489127,12123463,12634343,18052209,17293407,20361740,20444087,18554327,25099370,26883633,16272399,29923648