SubtiBank SubtiBank
yerH
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

yerH

unknown lipoprotein
locus
BSU_06630
pI
4.88
mw
44.36 kDa
protein length
396 aa Sequence Blast
gene length
1191 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    723,635 724,825

    The protein

    Structure

  • [PDB|4HN3] (from Listeria monocytogenes, 45% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0BA7EC658F5C2397A90B68AC234D04966966561C|pcrB]-[gene|C73E52D214E24F21696973B19B0A44CE785D6FBA|pcrA]-[gene|03EFF93C1B0CE075AE068ECC4EDE9BE5D03C857E|ligA]-[gene|ADAE6B5C301959D90592A6F26DFE1690BF6F5552|yerH]
    description
    [Pubmed|9701819]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B445 (yerH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1444 NBRP B. subtilis, Japan]
  • BKE06630 ([gene|ADAE6B5C301959D90592A6F26DFE1690BF6F5552|yerH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTTTCAATAGAAAACACT, downstream forward: _UP4_TGATAGAAAACCCTTGTGCC
  • BKK06630 ([gene|ADAE6B5C301959D90592A6F26DFE1690BF6F5552|yerH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTTTCAATAGAAAACACT, downstream forward: _UP4_TGATAGAAAACCCTTGTGCC
  • References

  • 16267290,9701819