SubtiBank SubtiBank
glcP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

glcP

probable glucose/mannose:H+ symporter
locus
BSU_10520
pI
8.77
mw
44.75 kDa
protein length
401 aa Sequence Blast
gene length
1206 bp Sequence Blast
function
unknown
product
probable glucose/mannose:H+ symporter
essential
no
synonyms
yhjI

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,125,123 1,126,328

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]
    description
    [Pubmed|17056753]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14612444], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|NtdR]: activation, in [regulon|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|NtdR regulon]
  • regulation

  • induced by 3,3'-neotrehalosadiamine ([protein|search|NtdR]) [Pubmed|14612444]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A723 (yhjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/723 NBRP B. subtilis, Japan]
  • BKE10520 ([gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTACACCCCTATAT, downstream forward: _UP4_TAGAAAACGTATAAAATAAA
  • BKK10520 ([gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTACACCCCTATAT, downstream forward: _UP4_TAGAAAACGTATAAAATAAA
  • References

    Reviews

  • 21512256
  • Original publications

  • 19087206,17056753,14612444,9457850