SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


sucrose permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBC of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT] activity
49.29 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
sucrose uptake and phosphorylation, control of [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT] activity
sucrose-specific [category|SW 1.2.2|PTS] permease, EIIBC component

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of sucrose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    3,903,646 3,905,031

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|BC568649A341B2E6341993EDA4BF52BDE18A3294|TreP], [protein|531F132F7F6A878F1E1D56977B9898A14272349A|SacX], [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|BglP], [protein|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|MurP]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8702561], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT]: antitermination, via binding to a [SW|RNA switch], in [regulon|6796E1C147AA21E919A42A953884DC24E182F430|SacT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]
  • view in new tab

    Biological materials


  • BKE38050 ([gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCCCCCTTTT, downstream forward: _UP4_AATGAGGATGAGGAGAGGAA
  • BKK38050 ([gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCCCCCTTTT, downstream forward: _UP4_AATGAGGATGAGGAGAGGAA
  • Expression vectors

  • for expression, purification of the EIIB domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP429, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of the EIIB domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP436, available in [SW|Jörg Stülke]'s lab
  • References

  • 10627040,12107147,3122206,2163394,8702561,2120236,22900538,30038046