SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[SW|YndF] germinant receptor of unknown specificity
57.84 kDa
protein length
520 aa Sequence Blast
gene length
1563 bp Sequence Blast
[category|SW 4.2.4|Germination]
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|YndF] germinant receptor

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.5|Germination/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,907,494 1,909,056

    The protein

    Protein family

  • [SW|GerABKA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|GerKA], [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|GerAA], [protein|3368743E6E03792DB83A38A19989123304DF7560|GerBA], [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ]
  • Structure

  • [PDB|6O59] (from B. megaterium, corresponds to aa 37 ... 298, 37.4% identity) [pubmed|31113879]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
  • view in new tab

    Biological materials


  • MGNA-A022 (yndD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17750 ([gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCACCTTCTTATACAT, downstream forward: _UP4_TGATGAACTCGACAGGATGG
  • BKK17750 ([gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCACCTTCTTATACAT, downstream forward: _UP4_TGATGAACTCGACAGGATGG
  • References

  • 15699190,16497325,10762253,31113879