SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to [SW|ABC transporter] (membrane protein)
27.64 kDa
protein length
246 aa Sequence Blast
gene length
741 bp Sequence Blast
[SW|ABC transporter] (membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    503,854 504,594

    The protein


  • cell membrane (according to UniProt)
  • Biological materials


  • MGNA-C118 (ydbK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04500 ([gene|AE61E6752DF0F681C6DEBB8CD0970C7CDDA6F78E|ydbK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCATTCCAAATTA, downstream forward: _UP4_TAAAGGCAAGGAATGACATT
  • BKK04500 ([gene|AE61E6752DF0F681C6DEBB8CD0970C7CDDA6F78E|ydbK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCATTCCAAATTA, downstream forward: _UP4_TAAAGGCAAGGAATGACATT
  • References

  • 10092453