SubtiBank SubtiBank
ydbK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydbK

similar to [SW|ABC transporter] (membrane protein)
locus
BSU_04500
pI
10.04
mw
27.64 kDa
protein length
246 aa Sequence Blast
gene length
741 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (membrane protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    503,854 504,594

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C118 (ydbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2116 NBRP B. subtilis, Japan]
  • BKE04500 ([gene|AE61E6752DF0F681C6DEBB8CD0970C7CDDA6F78E|ydbK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCATTCCAAATTA, downstream forward: _UP4_TAAAGGCAAGGAATGACATT
  • BKK04500 ([gene|AE61E6752DF0F681C6DEBB8CD0970C7CDDA6F78E|ydbK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTCATTCCAAATTA, downstream forward: _UP4_TAAAGGCAAGGAATGACATT
  • References

  • 10092453