SubtiBank SubtiBank
amhX
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

amhX

amidohydrolase
locus
BSU_03010
pI
6.12
mw
42.37 kDa
protein length
383 aa Sequence Blast
gene length
1152 bp Sequence Blast
function
unknown
product
amidohydrolase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    324,038 325,189

    The protein

    Protein family

  • [SW|peptidase M20 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C99AA3FDBB561BCED60915078DC746690C071753|SndB]
  • Structure

  • [PDB|1YSJ] (from ''Bacillus subtilis'' (32%) )
  • Expression and Regulation

    Operons

    genes
    [gene|AE824A62089631F129C3AA469B6ACA71DC13D2F8|amhX]
    description
    [Pubmed|8768514]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8768514], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE03010 ([gene|AE824A62089631F129C3AA469B6ACA71DC13D2F8|amhX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGAAATACCTCCT, downstream forward: _UP4_TAACGCAAAAAAAGCAGCCT
  • BKK03010 ([gene|AE824A62089631F129C3AA469B6ACA71DC13D2F8|amhX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGAAATACCTCCT, downstream forward: _UP4_TAACGCAAAAAAAGCAGCCT
  • References

  • 8768514,24843172